Regulog AlsR - Listeriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Allose utilization |
| Effector: | Allose-6-phosphate |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Listeriaceae
- By TF family - LacI
- By effector - Allose-6-phosphate
- By pathway - Allose utilization
| Genome | Genes | Operons |
|---|---|---|
| Listeria innocua Clip11262 | ||
| Listeria monocytogenes EGD-e | 6 | 2 |
| Listeria seeligeri serovar 1/2b str. SLCC3954 | ||
| Listeria welshimeri serovar 6b str. SLCC5334 | 3 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| alsR |
|
*
Listeria monocytogenes EGD-e Site: position = -34 score = 5.28269 sequence = AAATAAAAACGTTTACTCAT Site: position = -153 score = 5.47704 sequence = ATGAGTAATCGTTTTACCTT Site: position = -198 score = 5.62884 sequence = TTGAGATAACGATTACTCAT Gene: lmo0734: Transcriptional regulator of D-allose utilization, LacI family |
|
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -151 score = 5.25751 sequence = ACGGGTAATCGTTTTACCAT Site: position = -197 score = 5.62884 sequence = TTGAGATAACGATTACTCAT Site: position = -34 score = 5.39298 sequence = ATATATAAACGTTTACTCAA Gene: lwe0703: Transcriptional regulator of D-allose utilization, LacI family |
Transcriptional regulator of D-allose utilization, LacI family |
| CRON 2. | |||||
| alsE |
|
*
Listeria monocytogenes EGD-e Site: position = -80 score = 5.47704 sequence = AAGGTAAAACGATTACTCAT Site: position = -35 score = 5.62884 sequence = ATGAGTAATCGTTATCTCAA Site: position = -199 score = 5.28269 sequence = ATGAGTAAACGTTTTTATTT Gene: lmo0735: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) |
|
*
Listeria welshimeri serovar 6b str. SLCC5334 Site: position = -200 score = 5.39298 sequence = TTGAGTAAACGTTTATATAT Site: position = -37 score = 5.62884 sequence = ATGAGTAATCGTTATCTCAA Site: position = -83 score = 5.25751 sequence = ATGGTAAAACGATTACCCGT Gene: lwe0704: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) |
D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) |
| alsI |
|
Gene: lmo0736: D-allose-6-phosphate isomerase (EC 5.3.1.-) |
|
Gene: lwe0705: D-allose-6-phosphate isomerase (EC 5.3.1.-) |
D-allose-6-phosphate isomerase (EC 5.3.1.-) |
| lmo0737 |
|
Gene: lmo0737: hypothetical protein |
|
|
hypothetical protein |
| alsB |
|
Gene: lmo0738: PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69) |
|
|
PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69) |
| bglH |
|
Gene: lmo0739: 6-phospho-beta-glucosidase (EC 3.2.1.86) |
|
|
6-phospho-beta-glucosidase (EC 3.2.1.86) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |