Regulon of AlsR in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe0703
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Allose utilization
Effector:	Allose-6-phosphate
Regulog:	AlsR - Listeriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Allose-6-phosphate
By pathway - Allose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -200 Score: 5.4 Sequence: TTGAGTAAACGTTTATATAT Position: -83 Score: 5.3 Sequence: ATGGTAAAACGATTACCCGT Position: -37 Score: 5.6 Sequence: ATGAGTAATCGTTATCTCAA Locus tag: lwe0704 Name: alsE Funciton: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) Locus tag: lwe0705 Name: alsI Funciton: D-allose-6-phosphate isomerase (EC 5.3.1.-)
	lwe0704	alsE	D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
	lwe0705	alsI	D-allose-6-phosphate isomerase (EC 5.3.1.-)
Position: -197 Score: 5.6 Sequence: TTGAGATAACGATTACTCAT Position: -151 Score: 5.3 Sequence: ACGGGTAATCGTTTTACCAT Position: -34 Score: 5.4 Sequence: ATATATAAACGTTTACTCAA Locus tag: lwe0703 Name: alsR Funciton: Transcriptional regulator of D-allose utilization, LacI family
	lwe0703	alsR	Transcriptional regulator of D-allose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD