Profile of regulator AlsR in Listeriaceae

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Allose utilization
Effector:	Allose-6-phosphate
Regulog:	AlsR - Listeriaceae

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Allose-6-phosphate
By pathway - Allose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Listeria monocytogenes EGD-e
	lmo0734	alsR	-34	5.3	AAATAAAAACGTTTACTCAT
	lmo0735	alsE	-80	5.5	AAGGTAAAACGATTACTCAT
	lmo0735	alsE	-35	5.6	ATGAGTAATCGTTATCTCAA
	lmo0735	alsE	-199	5.3	ATGAGTAAACGTTTTTATTT
	lmo0734	alsR	-153	5.5	ATGAGTAATCGTTTTACCTT
	lmo0734	alsR	-198	5.6	TTGAGATAACGATTACTCAT
Listeria welshimeri serovar 6b str. SLCC5334
	lwe0703	alsR	-151	5.3	ACGGGTAATCGTTTTACCAT
	lwe0703	alsR	-197	5.6	TTGAGATAACGATTACTCAT
	lwe0703	alsR	-34	5.4	ATATATAAACGTTTACTCAA
	lwe0704	alsE	-200	5.4	TTGAGTAAACGTTTATATAT
	lwe0704	alsE	-37	5.6	ATGAGTAATCGTTATCTCAA
	lwe0704	alsE	-83	5.3	ATGGTAAAACGATTACCCGT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD