Regulon of AlsR in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo0734
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Allose utilization
Effector:	Allose-6-phosphate
Regulog:	AlsR - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Listeriaceae
By TF family - LacI
By effector - Allose-6-phosphate
By pathway - Allose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -199 Score: 5.3 Sequence: ATGAGTAAACGTTTTTATTT Position: -80 Score: 5.5 Sequence: AAGGTAAAACGATTACTCAT Position: -35 Score: 5.6 Sequence: ATGAGTAATCGTTATCTCAA Locus tag: lmo0735 Name: alsE Funciton: D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-) Locus tag: lmo0736 Name: alsI Funciton: D-allose-6-phosphate isomerase (EC 5.3.1.-) Locus tag: lmo0737 Name: null Funciton: hypothetical protein Locus tag: lmo0738 Name: alsB Funciton: PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69) Locus tag: lmo0739 Name: bglH Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
	lmo0735	alsE	D-allulose-6-phosphate 3-epimerase (EC 5.1.3.-)
	lmo0736	alsI	D-allose-6-phosphate isomerase (EC 5.3.1.-)
	lmo0737		hypothetical protein
	lmo0738	alsB	PTS system, D-allose-specific IIB component (EC 2.7.1.69) / PTS system, D-allose-specific IIC component (EC 2.7.1.69) / PTS system, D-allose-specific IIA component (EC 2.7.1.69)
	lmo0739	bglH	6-phospho-beta-glucosidase (EC 3.2.1.86)
Position: -198 Score: 5.6 Sequence: TTGAGATAACGATTACTCAT Position: -153 Score: 5.5 Sequence: ATGAGTAATCGTTTTACCTT Position: -34 Score: 5.3 Sequence: AAATAAAAACGTTTACTCAT Locus tag: lmo0734 Name: alsR Funciton: Transcriptional regulator of D-allose utilization, LacI family
	lmo0734	alsR	Transcriptional regulator of D-allose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD