Regulog RbsR - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Anaerocellum thermophilum DSM 6725 | ||
| Caldicellulosiruptor saccharolyticus DSM 8903 | ||
| Carboxydothermus hydrogenoformans Z-2901 | ||
| Moorella thermoacetica ATCC 39073 | ||
| Thermoanaerobacter ethanolicus X514 | 6 | 1 |
| Thermoanaerobacter italicus Ab9 | ||
| Thermoanaerobacter tengcongensis MB4 | 6 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| rbsR |
|
|
|
|
*
Thermoanaerobacter ethanolicus X514 Site: position = -53 score = 6.39561 sequence = ATAGTTAAGCGTTTTACTAA Site: position = -40 score = 5.99899 sequence = TTACTAAAACGTTAAACCAA Gene: Teth514_0161: Transcriptional repressor of ribose utilization, LacI famil |
|
*
Thermoanaerobacter tengcongensis MB4 Site: position = -53 score = 6.39561 sequence = ATAGTTAAGCGTTTTACTAA Site: position = -40 score = 6.21713 sequence = TTACTAAAACGTTAAACTAT Gene: TTE0201: Transcriptional repressor of ribose utilization, LacI famil |
Transcriptional repressor of ribose utilization, LacI famil |
| rbsK |
|
|
|
|
Gene: Teth514_0162: Ribokinase (EC 2.7.1.15) |
|
Gene: TTE0202: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsD |
|
|
|
|
Gene: Teth514_0163: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
Gene: TTE0203: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
|
|
|
|
Gene: Teth514_0164: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) |
|
Gene: TTE0204: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) |
Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) |
| rbsC |
|
|
|
|
Gene: Teth514_0165: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1) |
|
Gene: TTE0205: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1) |
Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1) |
| rbsB |
|
|
|
|
Gene: Teth514_0166: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1) |
|
Gene: TTE0206: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1) |
Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |