Regulog RbsR - Thermoanaerobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Anaerocellum thermophilum DSM 6725
Caldicellulosiruptor saccharolyticus DSM 8903
Carboxydothermus hydrogenoformans Z-2901
Moorella thermoacetica ATCC 39073
Thermoanaerobacter ethanolicus X514	6	1
Thermoanaerobacter italicus Ab9
Thermoanaerobacter tengcongensis MB4	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
rbsR	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	* Thermoanaerobacter ethanolicus X514 Site: position = -53 score = 6.39561 sequence = ATAGTTAAGCGTTTTACTAA Site: position = -40 score = 5.99899 sequence = TTACTAAAACGTTAAACCAA Gene: Teth514_0161: Transcriptional repressor of ribose utilization, LacI famil	Thermoanaerobacter italicus Ab9	* Thermoanaerobacter tengcongensis MB4 Site: position = -53 score = 6.39561 sequence = ATAGTTAAGCGTTTTACTAA Site: position = -40 score = 6.21713 sequence = TTACTAAAACGTTAAACTAT Gene: TTE0201: Transcriptional repressor of ribose utilization, LacI famil	Transcriptional repressor of ribose utilization, LacI famil
rbsK	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0162: Ribokinase (EC 2.7.1.15)	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0202: Ribokinase (EC 2.7.1.15)	Ribokinase (EC 2.7.1.15)
rbsD	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0163: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0203: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0164: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0204: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)	Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
rbsC	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0165: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0205: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)	Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
rbsB	Anaerocellum thermophilum DSM 6725	Caldicellulosiruptor saccharolyticus DSM 8903	Carboxydothermus hydrogenoformans Z-2901	Moorella thermoacetica ATCC 39073	Thermoanaerobacter ethanolicus X514 Gene: Teth514_0166: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)	Thermoanaerobacter italicus Ab9	Thermoanaerobacter tengcongensis MB4 Gene: TTE0206: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)	Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Thermoanaerobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --