Regulon of RbsR in Thermoanaerobacter tengcongensis MB4

Properties
Regulator type:	Transcription factor
TF locus tag:	TTE0201
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.4 Sequence: ATAGTTAAGCGTTTTACTAA Position: -40 Score: 6.2 Sequence: TTACTAAAACGTTAAACTAT Locus tag: TTE0201 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI famil Locus tag: TTE0202 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: TTE0203 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: TTE0204 Name: rbsA Funciton: Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1) Locus tag: TTE0205 Name: rbsC Funciton: Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1) Locus tag: TTE0206 Name: rbsB Funciton: Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)
	TTE0201	rbsR	Transcriptional repressor of ribose utilization, LacI famil
	TTE0202	rbsK	Ribokinase (EC 2.7.1.15)
	TTE0203	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	TTE0204	rbsA	Ribose ABC transporter, ATP-binding protein (TC 3.A.1.2.1)
	TTE0205	rbsC	Ribose ABC transporter, permease protein 2 (TC 3.A.1.2.1)
	TTE0206	rbsB	Ribose ABC transporter, substrate-binding protein (TC 3.A.1.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD