Regulog MalR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltodextrin utilization; Maltose utilization |
| Effector: | Maltose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltodextrin utilization
- By pathway - Maltose utilization
| Genome | Genes | Operons |
|---|---|---|
| Stenotrophomonas maltophilia K279a | 6 | 4 |
| Xanthomonas axonopodis pv. citri str. 306 | 7 | 5 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 7 | 5 |
| Xylella fastidiosa 9a5c |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| susB |
*
Stenotrophomonas maltophilia K279a Site: position = -90 score = 5.8648 sequence = AGCTGCATACGTATTCATGG Gene: Smlt1176: Alpha-glucosidase (EC 3.2.1.20) |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -104 score = 6.3734 sequence = CACTGCATACGTATTCATGG Gene: XAC2599: Alpha-glucosidase (EC 3.2.1.20) |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -103 score = 6.3734 sequence = CCCTGCATACGTATTCATGG Gene: XCC2468: Alpha-glucosidase (EC 3.2.1.20) |
|
Alpha-glucosidase (EC 3.2.1.20) |
| CRON 2. | |||||
| malZ |
*
Stenotrophomonas maltophilia K279a Site: position = -91 score = 6.40075 sequence = GCGTGAATACGTATGCAGGT Gene: Smlt1174: Maltodextrin glucosidase (EC 3.2.1.20) |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -107 score = 6.73718 sequence = CAATGAATACGTATGCACGT Gene: XAC2602: Maltodextrin glucosidase (EC 3.2.1.20) |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -107 score = 6.66446 sequence = CTATGAATACGTATGCACGG Gene: XCC2471: Maltodextrin glucosidase (EC 3.2.1.20) |
|
Maltodextrin glucosidase (EC 3.2.1.20) |
| CRON 3. | |||||
| amy |
|
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -163 score = 6.32868 sequence = CAGTGAATACGTATGCACAA Gene: XAC0798: Alpha-amylase EC=3.2.1.1 |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -164 score = 6.64051 sequence = CAGTGAATACGTATGCACAG Gene: XCC0748: Alpha-amylase EC=3.2.1.1 |
|
Alpha-amylase EC=3.2.1.1 |
| CRON 4. | |||||
| omp(Mal) |
*
Stenotrophomonas maltophilia K279a Site: position = -12 score = 6.73092 sequence = CATTGAATACGTATGCAGGG Gene: Smlt1175: Predicted maltose-specific outer membrane transporter, TonB-dependent |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -88 score = 6.70696 sequence = CAGTGAATACGTATGCAGTG Gene: XAC2600: Predicted maltose-specific outer membrane transporter, TonB-dependent |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -94 score = 6.27713 sequence = CGTTGAATACGTATGCAGGC Gene: XCC2469: Predicted maltose-specific outer membrane transporter, TonB-dependent |
|
Predicted maltose-specific outer membrane transporter, TonB-dependent |
| CRON 5. | |||||
| COG3408 |
*
Stenotrophomonas maltophilia K279a Site: position = -101 score = 6.4918 sequence = CCATGAATACGTATGCAGCT Gene: Smlt1177: Glycogen debranching enzyme |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -158 score = 6.7432 sequence = CCATGAATACGTATGCAGTG Gene: XAC2598: Glycogen debranching enzyme |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -159 score = 6.96395 sequence = CCATGAATACGTATGCAGGG Gene: XCC2467: Glycogen debranching enzyme |
|
Glycogen debranching enzyme |
| malT |
Gene: Smlt1178: Predicted maltose transporter MalT |
Gene: XAC2597: Predicted maltose transporter MalT |
Gene: XCC2466: Predicted maltose transporter MalT |
|
Predicted maltose transporter MalT |
| cgt |
Gene: Smlt1179: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
Gene: XAC2596: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
Gene: XCC2465: Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
|
Cyclomaltodextrin glucanotransferase EC=2.4.1.19 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |