Regulon of MalR in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt1186
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Regulog:	MalR - Xanthomonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltodextrin utilization
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 5.9 Sequence: AGCTGCATACGTATTCATGG Locus tag: Smlt1176 Name: susB Funciton: Alpha-glucosidase (EC 3.2.1.20)
	Smlt1176	susB	Alpha-glucosidase (EC 3.2.1.20)
Position: -91 Score: 6.4 Sequence: GCGTGAATACGTATGCAGGT Locus tag: Smlt1174 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	Smlt1174	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
Position: -12 Score: 6.7 Sequence: CATTGAATACGTATGCAGGG Locus tag: Smlt1175 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent
	Smlt1175	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
Position: -101 Score: 6.5 Sequence: CCATGAATACGTATGCAGCT Locus tag: Smlt1177 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: Smlt1178 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: Smlt1179 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
	Smlt1177	COG3408	Glycogen debranching enzyme
	Smlt1178	malT	Predicted maltose transporter MalT
	Smlt1179	cgt	Cyclomaltodextrin glucanotransferase EC=2.4.1.19

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD