Regulon of MalR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC2464
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Regulog:	MalR - Xanthomonadales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltodextrin utilization
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 6.4 Sequence: CCCTGCATACGTATTCATGG Locus tag: XCC2468 Name: susB Funciton: Alpha-glucosidase (EC 3.2.1.20)
	XCC2468	susB	Alpha-glucosidase (EC 3.2.1.20)
Position: -164 Score: 6.6 Sequence: CAGTGAATACGTATGCACAG Locus tag: XCC0748 Name: amy Funciton: Alpha-amylase EC=3.2.1.1
	XCC0748	amy	Alpha-amylase EC=3.2.1.1
Position: -107 Score: 6.7 Sequence: CTATGAATACGTATGCACGG Locus tag: XCC2471 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	XCC2471	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
Position: -94 Score: 6.3 Sequence: CGTTGAATACGTATGCAGGC Locus tag: XCC2469 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent
	XCC2469	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
Position: -159 Score: 7 Sequence: CCATGAATACGTATGCAGGG Locus tag: XCC2467 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: XCC2466 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: XCC2465 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
	XCC2467	COG3408	Glycogen debranching enzyme
	XCC2466	malT	Predicted maltose transporter MalT
	XCC2465	cgt	Cyclomaltodextrin glucanotransferase EC=2.4.1.19

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD