Regulon of MalR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC2595
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltodextrin utilization; Maltose utilization
Effector:	Maltose
Regulog:	MalR - Xanthomonadales
Statistics of regulated genes:
- Genes	7
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By effector - Maltose
By pathway - Maltodextrin utilization
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6.7 Sequence: CAATGAATACGTATGCACGT Locus tag: XAC2602 Name: malZ Funciton: Maltodextrin glucosidase (EC 3.2.1.20)
	XAC2602	malZ	Maltodextrin glucosidase (EC 3.2.1.20)
Position: -163 Score: 6.3 Sequence: CAGTGAATACGTATGCACAA Locus tag: XAC0798 Name: amy Funciton: Alpha-amylase EC=3.2.1.1
	XAC0798	amy	Alpha-amylase EC=3.2.1.1
Position: -104 Score: 6.4 Sequence: CACTGCATACGTATTCATGG Locus tag: XAC2599 Name: susB Funciton: Alpha-glucosidase (EC 3.2.1.20)
	XAC2599	susB	Alpha-glucosidase (EC 3.2.1.20)
Position: -88 Score: 6.7 Sequence: CAGTGAATACGTATGCAGTG Locus tag: XAC2600 Name: omp(Mal) Funciton: Predicted maltose-specific outer membrane transporter, TonB-dependent
	XAC2600	omp(Mal)	Predicted maltose-specific outer membrane transporter, TonB-dependent
Position: -158 Score: 6.7 Sequence: CCATGAATACGTATGCAGTG Locus tag: XAC2598 Name: COG3408 Funciton: Glycogen debranching enzyme Locus tag: XAC2597 Name: malT Funciton: Predicted maltose transporter MalT Locus tag: XAC2596 Name: cgt Funciton: Cyclomaltodextrin glucanotransferase EC=2.4.1.19
	XAC2598	COG3408	Glycogen debranching enzyme
	XAC2597	malT	Predicted maltose transporter MalT
	XAC2596	cgt	Cyclomaltodextrin glucanotransferase EC=2.4.1.19

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD