Regulog Phr - Archaeoglobales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | |
| Phylum: | Euryarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Archaeoglobales
- By trascription factor - Phr
- By TF family - ArsR
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Archaeoglobus fulgidus DSM 4304 | 4 | 2 |
| Archaeoglobus profundus DSM 5631 | 4 | 2 |
| Ferroglobus placidus DSM 10642 | 4 | 2 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| phr |
*
Archaeoglobus fulgidus DSM 4304 Site: position = -34 score = 6.31493 sequence = AAACCTAACATAAAGTTAGTAAC Gene: AF1298: Heat shock response regulator Phr, ArsR family |
*
Archaeoglobus profundus DSM 5631 Site: position = -43 score = 6.51041 sequence = TTTACTAACCAAAAGTTAGTAAA Gene: Arcpr_0812: Heat shock response regulator Phr, ArsR family |
*
Ferroglobus placidus DSM 10642 Site: position = -58 score = 6.34567 sequence = TTTACTAACACAAAGTTAGTAAC Gene: Ferp_0217: Heat shock response regulator Phr, ArsR family |
Heat shock response regulator Phr, ArsR family |
| vat |
Gene: AF1297: ATPase, AAA+ family |
Gene: Arcpr_0811: ATPase, AAA+ family |
Gene: Ferp_0216: ATPase, AAA+ family |
ATPase, AAA+ family |
| hsp20-1 |
Gene: AF1296: Small heat shock protein 20 |
Gene: Arcpr_0810: Small heat shock protein 20 |
Gene: Ferp_0215: Small heat shock protein 20 |
Small heat shock protein 20 |
| CRON 2. | ||||
| hsp20-2 |
*
Archaeoglobus fulgidus DSM 4304 Site: position = -56 score = 6.03738 sequence = CTACCTAACATAAAGTTAGGTTA Gene: AF1971: Small heat shock protein 20 |
*
Archaeoglobus profundus DSM 5631 Site: position = -48 score = 6.20028 sequence = TTTACTAACTAAAGGTTAGTAGT Gene: Arcpr_1089: Small heat shock protein 20 |
*
Ferroglobus placidus DSM 10642 Site: position = -46 score = 6.577 sequence = AATCCTAACTTAAAGTTAGGATT Gene: Ferp_0363: Small heat shock protein 20 |
Small heat shock protein 20 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |