Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hsp20-1 gene

Properties
Regulog: Phr - Archaeoglobales
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Heat shock response
Effector:
Phylum: Euryarchaeota
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Archaeoglobus fulgidus DSM 4304
Position: -34
Score: 6.31493
Sequence: AAACCTAACATAAAGTTAGTAAC
Locus tag: AF1298
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: AF1297
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: AF1296
Name: hsp20-1
Funciton: Small heat shock protein 20
phr-vat-hsp20-1 -34 6.3 AAACCTAACATAAAGTTAGTAAC AF1298
Archaeoglobus profundus DSM 5631
Position: -43
Score: 6.51041
Sequence: TTTACTAACCAAAAGTTAGTAAA
Locus tag: Arcpr_0812
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Arcpr_0811
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: Arcpr_0810
Name: hsp20-1
Funciton: Small heat shock protein 20
phr-vat-hsp20-1 -43 6.5 TTTACTAACCAAAAGTTAGTAAA Arcpr_0812
Ferroglobus placidus DSM 10642
Position: -58
Score: 6.34567
Sequence: TTTACTAACACAAAGTTAGTAAC
Locus tag: Ferp_0217
Name: phr
Funciton: Heat shock response regulator Phr, ArsR family
Locus tag: Ferp_0216
Name: vat
Funciton: ATPase, AAA+ family
Locus tag: Ferp_0215
Name: hsp20-1
Funciton: Small heat shock protein 20
phr-vat-hsp20-1 -58 6.3 TTTACTAACACAAAGTTAGTAAC Ferp_0217