Regulon of Phr in Archaeoglobus profundus DSM 5631

Properties
Regulator type:	Transcription factor
TF locus tag:	Arcpr_0812
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:
Regulog:	Phr - Archaeoglobales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Archaeoglobales
By trascription factor - Phr
By TF family - ArsR
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 6.5 Sequence: TTTACTAACCAAAAGTTAGTAAA Locus tag: Arcpr_0812 Name: phr Funciton: Heat shock response regulator Phr, ArsR family Locus tag: Arcpr_0811 Name: vat Funciton: ATPase, AAA+ family Locus tag: Arcpr_0810 Name: hsp20-1 Funciton: Small heat shock protein 20
	Arcpr_0812	phr	Heat shock response regulator Phr, ArsR family
	Arcpr_0811	vat	ATPase, AAA+ family
	Arcpr_0810	hsp20-1	Small heat shock protein 20
Position: -48 Score: 6.2 Sequence: TTTACTAACTAAAGGTTAGTAGT Locus tag: Arcpr_1089 Name: hsp20-2 Funciton: Small heat shock protein 20
	Arcpr_1089	hsp20-2	Small heat shock protein 20

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD