Regulog Nfa3720 - Nocardiaceae

Member of regulog collections
- By taxonomy - Nocardiaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
Genome | Genes | Operons |
---|---|---|
Nocardia farcinica IFM 10152 | 3 | 1 |
Rhodococcus erythropolis PR4 | 3 | 1 |
Rhodococcus opacus B4 | 3 | 1 |
Rhodococcus sp. RHA1 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
Nfa3720 |
*
Nocardia farcinica IFM 10152 Site: position = -20 score = 6.99866 sequence = TATGGTTCATTACATGAGTAATGAACCACT Gene: nfa3720: Transcriptional regulator, GntR family |
*
Rhodococcus erythropolis PR4 Site: position = -51 score = 6.60131 sequence = TATGGTTCATTACATGAGCAATGAACCAGT Gene: RER_12520: Transcriptional regulator, GntR family |
*
Rhodococcus opacus B4 Site: position = -51 score = 6.96152 sequence = TATGGTTCATTACATGAGTAATGAACCGAT Gene: ROP_66420: Transcriptional regulator, GntR family |
|
Transcriptional regulator, GntR family |
lp_2743 |
Gene: nfa3730: ABC-type multidrug transport system, ATPase component |
Gene: RER_12510: ABC-type multidrug transport system, ATPase component |
Gene: ROP_66410: ABC-type multidrug transport system, ATPase component |
Gene: RHA1_ro06607: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
lp_2744 |
Gene: nfa3740: ABC-type multidrug transport system, permease component |
Gene: RER_12500: ABC-type multidrug transport system, permease component |
Gene: ROP_66400: ABC-type multidrug transport system, permease component |
Gene: RHA1_ro06606: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |