Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing lp_2743 gene

Properties
Regulog: Nfa3720 - Nocardiaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Actinobacteria
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -20
Score: 6.99866
Sequence: TATGGTTCATTACATGAGTAATGAACCACT
Locus tag: nfa3720
Name: Nfa3720
Funciton: Transcriptional regulator, GntR family
Locus tag: nfa3730
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: nfa3740
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744 -20 7 TATGGTTCATTACATGAGTAATGAACCACT nfa3720
Rhodococcus erythropolis PR4
Position: -51
Score: 6.60131
Sequence: TATGGTTCATTACATGAGCAATGAACCAGT
Locus tag: RER_12520
Name: Nfa3720
Funciton: Transcriptional regulator, GntR family
Locus tag: RER_12510
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: RER_12500
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744 -51 6.6 TATGGTTCATTACATGAGCAATGAACCAGT RER_12520
Rhodococcus opacus B4
Position: -51
Score: 6.96152
Sequence: TATGGTTCATTACATGAGTAATGAACCGAT
Locus tag: ROP_66420
Name: Nfa3720
Funciton: Transcriptional regulator, GntR family
Locus tag: ROP_66410
Name: lp_2743
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: ROP_66400
Name: lp_2744
Funciton: ABC-type multidrug transport system, permease component
Nfa3720-lp_2743-lp_2744 -51 7 TATGGTTCATTACATGAGTAATGAACCGAT ROP_66420