Regulon of Nfa3720 in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_66420
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Regulog:	Nfa3720 - Nocardiaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 7 Sequence: TATGGTTCATTACATGAGTAATGAACCGAT Locus tag: ROP_66420 Name: Nfa3720 Funciton: Transcriptional regulator, GntR family Locus tag: ROP_66410 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: ROP_66400 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	ROP_66420	Nfa3720	Transcriptional regulator, GntR family
	ROP_66410	lp_2743	ABC-type multidrug transport system, ATPase component
	ROP_66400	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD