Regulog BglR - Deinococcus-Thermus
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Deinococcus-Thermus |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Deinococcus-Thermus
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Deinococcus deserti VCD115 | 5 | 1 |
| Deinococcus geothermalis DSM 11300 | 5 | 2 |
| Deinococcus radiodurans R1 | ||
| Thermus aquaticus Y51MC23 | ||
| Thermus thermophilus HB27 | 5 | 1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| bglR |
*
Deinococcus deserti VCD115 Site: position = -90 score = 6.3397 sequence = TCTTGACAGCGCTTTCAAAA Gene: Deide_00590: Transcriptional regulator for beta-glucoside utilization, LacI family |
*
Deinococcus geothermalis DSM 11300 Site: position = -31 score = 5.81734 sequence = TTTTGCAACCGCTTTCAGAT Gene: Dgeo_2858: Transcriptional regulator for beta-glucoside utilization, LacI family |
|
|
*
Thermus thermophilus HB27 Site: position = -21 score = 6.31082 sequence = TCTTGCAAGCGCTTTCAACA Gene: TTP0038: Transcriptional regulator for beta-glucoside utilization, LacI family |
Transcriptional regulator for beta-glucoside utilization, LacI family |
| bglE |
Gene: Deide_00580: Predicted beta-glucoside ABC transporter, periplasmic component |
*
Deinococcus geothermalis DSM 11300 Site: position = -147 score = 5.55305 sequence = GTTGACAAGCGCTTTCAAAG Gene: Dgeo_2859: Predicted beta-glucoside ABC transporter, periplasmic component |
|
|
Gene: TTP0039: Predicted beta-glucoside ABC transporter, periplasmic component |
Predicted beta-glucoside ABC transporter, periplasmic component |
| bglF |
Gene: Deide_00570: Predicted beta-glucoside ABC transporter, permease component |
Gene: Dgeo_2860: Predicted beta-glucoside ABC transporter, permease component |
|
|
Gene: TTP0040: Predicted beta-glucoside ABC transporter, permease component |
Predicted beta-glucoside ABC transporter, permease component |
| bglG |
Gene: Deide_00560: Predicted beta-glucoside ABC transporter, permease component |
Gene: Dgeo_2861: Predicted beta-glucoside ABC transporter, permease component |
|
|
Gene: TTP0041: Predicted beta-glucoside ABC transporter, permease component |
Predicted beta-glucoside ABC transporter, permease component |
| bglB |
Gene: Deide_00550: Beta-glucosidase (EC 3.2.1.21) |
Gene: Dgeo_2862: Beta-glucosidase (EC 3.2.1.21) |
|
|
Gene: TTP0042: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |