Regulon of BglR in Deinococcus deserti VCD115

Properties
Regulator type:	Transcription factor
TF locus tag:	Deide_00590
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Deinococcus-Thermus
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Deinococcus-Thermus
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -90 Score: 6.3 Sequence: TCTTGACAGCGCTTTCAAAA Locus tag: Deide_00590 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: Deide_00580 Name: bglE Funciton: Predicted beta-glucoside ABC transporter, periplasmic component Locus tag: Deide_00570 Name: bglF Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Deide_00560 Name: bglG Funciton: Predicted beta-glucoside ABC transporter, permease component Locus tag: Deide_00550 Name: bglB Funciton: Beta-glucosidase (EC 3.2.1.21)
	Deide_00590	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
	Deide_00580	bglE	Predicted beta-glucoside ABC transporter, periplasmic component
	Deide_00570	bglF	Predicted beta-glucoside ABC transporter, permease component
	Deide_00560	bglG	Predicted beta-glucoside ABC transporter, permease component
	Deide_00550	bglB	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD