Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing bglF gene

Properties
Regulog: BglR - Deinococcus-Thermus
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Phylum: Deinococcus-Thermus
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Deinococcus deserti VCD115
Position: -90
Score: 6.3397
Sequence: TCTTGACAGCGCTTTCAAAA
Locus tag: Deide_00590
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: Deide_00580
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: Deide_00570
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Deide_00560
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Deide_00550
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglR-bglE-bglF-bglG-bglB -90 6.3 TCTTGACAGCGCTTTCAAAA Deide_00590
Deinococcus geothermalis DSM 11300
Position: -147
Score: 5.55305
Sequence: GTTGACAAGCGCTTTCAAAG
Locus tag: Dgeo_2859
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: Dgeo_2860
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Dgeo_2861
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: Dgeo_2862
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglE-bglF-bglG-bglB -147 5.6 GTTGACAAGCGCTTTCAAAG Dgeo_2859
Thermus thermophilus HB27
Position: -21
Score: 6.31082
Sequence: TCTTGCAAGCGCTTTCAACA
Locus tag: TTP0038
Name: bglR
Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family
Locus tag: TTP0039
Name: bglE
Funciton: Predicted beta-glucoside ABC transporter, periplasmic component
Locus tag: TTP0040
Name: bglF
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0041
Name: bglG
Funciton: Predicted beta-glucoside ABC transporter, permease component
Locus tag: TTP0042
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
bglR-bglE-bglF-bglG-bglB -21 6.3 TCTTGCAAGCGCTTTCAACA TTP0038