Regulog RafR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Raffinose utilization |
| Effector: | Raffinose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Raffinose
- By pathway - Raffinose utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 2 | 1 |
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | 2 | 1 |
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 2 | 1 |
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM | 1 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| rafR |
|
|
Gene: Ent638_4078: Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family |
|
Gene: ECA0755: Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family |
|
Gene: KPN_04202: Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family |
|
|
|
|
*
Yersinia pestis KIM Site: position = -214 score = 6.71996 sequence = GATCCGAAACGTTTCGGATT Site: position = -193 score = 6.2754 sequence = AAATCTAAACGTTTCGGATG Gene: y2579: Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family |
Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family |
| CRON 2. | |||||||||||||
| rafA |
|
|
*
Enterobacter sp. 638 Site: position = -54 score = 6.41527 sequence = TATCCGAAACGTTTCGGATC Site: position = -75 score = 6.08979 sequence = AATCCGAAACGTTTGGGTTG Gene: Ent638_4077: Alpha-galactosidase (EC 3.2.1.22) |
|
*
Erwinia carotovora subsp. atroseptica SCRI1043 Site: position = -90 score = 4.9691 sequence = TTTCTTAAACGTTTAAGTTG Site: position = -69 score = 4.88333 sequence = TCACTTAAACGTTTAAGTTT Gene: ECA0754: Alpha-galactosidase (EC 3.2.1.22) |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -54 score = 6.63607 sequence = CATCCGAAACGTTTCGGATC Site: position = -75 score = 6.10104 sequence = GATCCGAAACGTTTTGGTTG Gene: KPN_04203: Alpha-galactosidase (EC 3.2.1.22) |
|
|
|
|
Gene: y2582: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
| rafY |
|
|
Gene: Ent638_4076: Raffinose permease |
|
Gene: ECA0753: Raffinose permease |
|
Gene: KPN_04204: Raffinose permease |
|
|
|
|
Gene: y2581: Raffinose permease |
Raffinose permease |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |