Regulon of RafR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y2579
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Raffinose utilization
Effector:	Raffinose
Regulog:	RafR - Enterobacteriales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Raffinose
By pathway - Raffinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -214 Score: 6.7 Sequence: GATCCGAAACGTTTCGGATT Position: -193 Score: 6.3 Sequence: AAATCTAAACGTTTCGGATG Locus tag: y2579 Name: rafR Funciton: Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family
	y2579	rafR	Transcriptional regulator for raffinose and alpha-galactoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD