Regulon of RafR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_4078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Raffinose utilization
Effector:	Raffinose
Regulog:	RafR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Raffinose
By pathway - Raffinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 6.1 Sequence: AATCCGAAACGTTTGGGTTG Position: -54 Score: 6.4 Sequence: TATCCGAAACGTTTCGGATC Locus tag: Ent638_4077 Name: rafA Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Ent638_4076 Name: rafY Funciton: Raffinose permease
	Ent638_4077	rafA	Alpha-galactosidase (EC 3.2.1.22)
	Ent638_4076	rafY	Raffinose permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD