Regulog BH1250 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | 5 | 1 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus clausii KSM-K16 | 6 | 2 |
| Bacillus halodurans C-125 | 8 | 2 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BH1244 |
Gene: Aflv_2274: Predicted sugar ABC transporter, substrate-binding protein |
|
|
|
*
Bacillus halodurans C-125 Site: position = -102 score = 5.6098 sequence = ATATGAGAACGATTCCATAG Site: position = -32 score = 5.28819 sequence = ATGTGAAATCGATTCCATAT Gene: BH1244: Predicted sugar ABC transporter, substrate-binding protein |
|
|
|
Gene: GK2123: Predicted sugar ABC transporter, substrate-binding protein |
Gene: OB3474: Predicted sugar ABC transporter, substrate-binding protein |
|
Predicted sugar ABC transporter, substrate-binding protein |
| BH1245 |
Gene: Aflv_2273: Predicted sugar ABC transporter, permease protein 1 |
|
|
|
Gene: BH1245: Predicted sugar ABC transporter, permease protein 1 |
|
|
|
Gene: GK2122: Predicted sugar ABC transporter, permease protein 1 |
Gene: OB3473: Predicted sugar ABC transporter, permease protein 1 |
|
Predicted sugar ABC transporter, permease protein 1 |
| BH1246 |
Gene: Aflv_2272: Predicted sugar ABC transporter, permease protein 2 |
|
|
|
Gene: BH1246: Predicted sugar ABC transporter, permease protein 2 |
|
|
|
Gene: GK2121: Predicted sugar ABC transporter, permease protein 2 |
Gene: OB3472: Predicted sugar ABC transporter, permease protein 2 |
|
Predicted sugar ABC transporter, permease protein 2 |
| BH1247 |
|
|
|
Gene: ABC1573: Conserved hypothetical protein |
Gene: BH1247: Conserved hypothetical protein |
|
|
|
Gene: GK2113: Conserved hypothetical protein |
Gene: OB2566: Conserved hypothetical protein |
Gene: Pjdr2_5588: Conserved hypothetical protein |
Conserved hypothetical protein |
| BH1248 |
|
|
|
Gene: ABC0796: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
Gene: BH1248: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
|
|
|
|
Gene: OB2565: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
Gene: Pjdr2_4891: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
| BH1249 |
|
|
|
*
Bacillus clausii KSM-K16 Site: position = -31 score = 4.92242 sequence = ATATGAGATCGATCTCAGAG Gene: ABC0795: Inosose isomerase (EC 5.3.99.-) |
Gene: BH1249: Inosose isomerase (EC 5.3.99.-) |
|
|
|
Gene: GK2111: Inosose isomerase (EC 5.3.99.-) |
Gene: OB2563: Inosose isomerase (EC 5.3.99.-) |
Gene: Pjdr2_5725: Inosose isomerase (EC 5.3.99.-) |
Inosose isomerase (EC 5.3.99.-) |
| BH1250 |
*
Anoxybacillus flavithermus WK1 Site: position = -56 score = 6.26112 sequence = ATATGAAAACGATTTCATTC Gene: Aflv_2275: Predicted sugar utilization transcriptional regulator, LacI family |
|
*
Bacillus cereus ATCC 14579 Site: position = -96 score = 5.89714 sequence = TTAAGAAAACGTTTTCATGC Gene: BC1083: Predicted sugar utilization transcriptional regulator, LacI family |
*
Bacillus clausii KSM-K16 Site: position = -33 score = 5.86697 sequence = AAATGAGAACGTTTTCAATA Gene: ABC1572: Predicted sugar utilization transcriptional regulator, LacI family |
Gene: BH1250: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
|
|
|
Predicted sugar utilization transcriptional regulator, LacI family |
| BH2903 |
Gene: Aflv_2271: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
*
Bacillus cereus ATCC 14579 Site: position = -183 score = 6.05731 sequence = AAAATAAAACGTTTTCATAT Site: position = -241 score = 5.43801 sequence = TTATGCAAACGTTTTCTTTG Gene: BC4015: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
*
Bacillus halodurans C-125 Site: position = -32 score = 4.6702 sequence = TTACGTAAACGTTTTCGTTA Gene: BH2903: Oligo-1,6-glucosidase (EC 3.2.1.10) |
|
|
|
|
|
|
Oligo-1,6-glucosidase (EC 3.2.1.10) |
| ABC1574 |
|
|
|
Gene: ABC1574: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
|
|
|
|
|
Gene: OB2564: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
|
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
| ABC0797 |
|
|
|
Gene: ABC0797: Inosose dehydratase (EC 4.2.1.44) |
|
|
|
|
|
|
|
Inosose dehydratase (EC 4.2.1.44) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |