Regulon of BH1250 in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH1250
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	BH1250 - Bacillales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -32 Score: 4.7 Sequence: TTACGTAAACGTTTTCGTTA Locus tag: BH2903 Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
	BH2903	BH2903	Oligo-1,6-glucosidase (EC 3.2.1.10)
Position: -102 Score: 5.6 Sequence: ATATGAGAACGATTCCATAG Position: -32 Score: 5.3 Sequence: ATGTGAAATCGATTCCATAT Locus tag: BH1244 Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: BH1245 Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: BH1246 Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: BH1247 Name: BH1247 Funciton: Conserved hypothetical protein Locus tag: BH1248 Name: BH1248 Funciton: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) Locus tag: BH1249 Name: BH1249 Funciton: Inosose isomerase (EC 5.3.99.-) Locus tag: BH1250 Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	BH1244	BH1244	Predicted sugar ABC transporter, substrate-binding protein
	BH1245	BH1245	Predicted sugar ABC transporter, permease protein 1
	BH1246	BH1246	Predicted sugar ABC transporter, permease protein 2
	BH1247	BH1247	Conserved hypothetical protein
	BH1248	BH1248	Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
	BH1249	BH1249	Inosose isomerase (EC 5.3.99.-)
	BH1250	BH1250	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD