Regulon of BH1250 in Anoxybacillus flavithermus WK1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aflv_2275
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	BH1250 - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6.3 Sequence: ATATGAAAACGATTTCATTC Locus tag: Aflv_2275 Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Aflv_2274 Name: BH1244 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: Aflv_2273 Name: BH1245 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: Aflv_2272 Name: BH1246 Funciton: Predicted sugar ABC transporter, permease protein 2 Locus tag: Aflv_2271 Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
	Aflv_2275	BH1250	Predicted sugar utilization transcriptional regulator, LacI family
	Aflv_2274	BH1244	Predicted sugar ABC transporter, substrate-binding protein
	Aflv_2273	BH1245	Predicted sugar ABC transporter, permease protein 1
	Aflv_2272	BH1246	Predicted sugar ABC transporter, permease protein 2
	Aflv_2271	BH2903	Oligo-1,6-glucosidase (EC 3.2.1.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD