Regulon of BH1250 in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC1083
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	BH1250 - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -241 Score: 5.4 Sequence: TTATGCAAACGTTTTCTTTG Position: -183 Score: 6.1 Sequence: AAAATAAAACGTTTTCATAT Locus tag: BC4015 Name: BH2903 Funciton: Oligo-1,6-glucosidase (EC 3.2.1.10)
	BC4015	BH2903	Oligo-1,6-glucosidase (EC 3.2.1.10)
Position: -96 Score: 5.9 Sequence: TTAAGAAAACGTTTTCATGC Locus tag: BC1083 Name: BH1250 Funciton: Predicted sugar utilization transcriptional regulator, LacI family
	BC1083	BH1250	Predicted sugar utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD