Regulog GalR - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Desulfohalobium retbaense DSM 5692 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfovibrio desulfuricans G20 | 8 | 2 |
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
| Desulfovibrio magneticus RS-1 | ||
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | 8 | 2 |
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Lawsonia intracellularis PHE/MN1-00 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| galR |
|
|
*
Desulfovibrio desulfuricans G20 Site: position = -51 score = 6.14657 sequence = AACTGCAAACGTTTGCAGCA Gene: Dde_3654: Galactose utilization transcriptional regulator GalR, LacI family |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -101 score = 5.1603 sequence = AATGGAAAAGGTTTTCGGTA Gene: Desal_0506: Galactose utilization transcriptional regulator GalR, LacI family |
|
|
|
Galactose utilization transcriptional regulator GalR, LacI family |
| galM |
|
|
Gene: Dde_3655: Aldose 1-epimerase EC=5.1.3.3 |
|
|
|
Gene: Desal_0505: Aldose 1-epimerase EC=5.1.3.3 |
|
|
|
Aldose 1-epimerase EC=5.1.3.3 |
| galA |
|
|
Gene: Dde_3656: Predicted galactose-specific ABC transporter, ATP-binding component |
|
|
|
Gene: Desal_0504: Predicted galactose-specific ABC transporter, ATP-binding component |
|
|
|
Predicted galactose-specific ABC transporter, ATP-binding component |
| galB |
|
|
Gene: Dde_3657: Predicted galactose-specific ABC transporter, periplasmic component |
|
|
|
Gene: Desal_0503: Predicted galactose-specific ABC transporter, periplasmic component |
|
|
|
Predicted galactose-specific ABC transporter, periplasmic component |
| galC |
|
|
Gene: Dde_3658: Predicted galactose-specific ABC transporter, permease components |
|
|
|
Gene: Desal_0502: Predicted galactose-specific ABC transporter, permease components |
|
|
|
Predicted galactose-specific ABC transporter, permease components |
| galD |
|
|
Gene: Dde_3659: Predicted galactose-specific ABC transporter, permease protein |
|
|
|
Gene: Desal_0501: Predicted galactose-specific ABC transporter, permease protein |
|
|
|
Predicted galactose-specific ABC transporter, permease protein |
| CRON 2. | |||||||||||
| galT |
|
|
*
Desulfovibrio desulfuricans G20 Site: position = -91 score = 5.67198 sequence = AATTGCAAACGTTTGCATCA Gene: Dde_3652: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
|
|
|
*
Desulfovibrio salexigens DSM 2638 Site: position = -39 score = 5.14592 sequence = TTGCACAATCGTTTGCAGAA Site: position = -63 score = 5.98522 sequence = TTCCGAAAACGTTTGCGGTT Gene: Desal_0508: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
|
|
|
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
| galK |
|
|
Gene: Dde_3653: Galactokinase (EC 2.7.1.6) |
|
|
|
Gene: Desal_0507: Galactokinase (EC 2.7.1.6) |
|
|
|
Galactokinase (EC 2.7.1.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |