Regulon of GalR in Desulfovibrio salexigens DSM 2638

Properties
Regulator type:	Transcription factor
TF locus tag:	Desal_0506
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6 Sequence: TTCCGAAAACGTTTGCGGTT Position: -39 Score: 5.1 Sequence: TTGCACAATCGTTTGCAGAA Locus tag: Desal_0508 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: Desal_0507 Name: null Funciton: Galactokinase (EC 2.7.1.6)
	Desal_0508	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	Desal_0507		Galactokinase (EC 2.7.1.6)
Position: -101 Score: 5.2 Sequence: AATGGAAAAGGTTTTCGGTA Locus tag: Desal_0506 Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family Locus tag: Desal_0505 Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3 Locus tag: Desal_0504 Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component Locus tag: Desal_0503 Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component Locus tag: Desal_0502 Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components Locus tag: Desal_0501 Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein
	Desal_0506	galR	Galactose utilization transcriptional regulator GalR, LacI family
	Desal_0505	galM	Aldose 1-epimerase EC=5.1.3.3
	Desal_0504	galA	Predicted galactose-specific ABC transporter, ATP-binding component
	Desal_0503	galB	Predicted galactose-specific ABC transporter, periplasmic component
	Desal_0502	galC	Predicted galactose-specific ABC transporter, permease components
	Desal_0501	galD	Predicted galactose-specific ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD