Regulon of GalR in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_3654
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 5.7 Sequence: AATTGCAAACGTTTGCATCA Locus tag: Dde_3652 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: Dde_3653 Name: galK Funciton: Galactokinase (EC 2.7.1.6)
	Dde_3652	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	Dde_3653	galK	Galactokinase (EC 2.7.1.6)
Position: -51 Score: 6.1 Sequence: AACTGCAAACGTTTGCAGCA Locus tag: Dde_3654 Name: galR Funciton: Galactose utilization transcriptional regulator GalR, LacI family Locus tag: Dde_3655 Name: galM Funciton: Aldose 1-epimerase EC=5.1.3.3 Locus tag: Dde_3656 Name: galA Funciton: Predicted galactose-specific ABC transporter, ATP-binding component Locus tag: Dde_3657 Name: galB Funciton: Predicted galactose-specific ABC transporter, periplasmic component Locus tag: Dde_3658 Name: galC Funciton: Predicted galactose-specific ABC transporter, permease components Locus tag: Dde_3659 Name: galD Funciton: Predicted galactose-specific ABC transporter, permease protein
	Dde_3654	galR	Galactose utilization transcriptional regulator GalR, LacI family
	Dde_3655	galM	Aldose 1-epimerase EC=5.1.3.3
	Dde_3656	galA	Predicted galactose-specific ABC transporter, ATP-binding component
	Dde_3657	galB	Predicted galactose-specific ABC transporter, periplasmic component
	Dde_3658	galC	Predicted galactose-specific ABC transporter, permease components
	Dde_3659	galD	Predicted galactose-specific ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD