Regulog SgaR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By TF family - LacI
- By effector - Ascorbate-6-phosphate
- By pathway - Ascorbate utilization
| Genome | Genes | Operons |
|---|---|---|
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 4 | 2 |
| Aeromonas salmonicida subsp. salmonicida A449 | 4 | 2 |
| Moritella sp. PE36 | ||
| Psychromonas ingrahamii 37 | 4 | 2 |
| Psychromonas sp. CNPT3 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| sgaR |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -180 score = 4.79295 sequence = GAAAGTTAGCGCTACCAGAT Site: position = -145 score = 6.50021 sequence = CTGTGATAGCGCTATCATTT Gene: AHA_0174: Ascorbate utilization transcriptional regulator SgaR, LacI family |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -167 score = 4.62619 sequence = ACCAGATAGCGCTAACATGG Site: position = -145 score = 6.33806 sequence = TTGTGATAGCGCTATCATTT Gene: ASA_4215: Ascorbate utilization transcriptional regulator SgaR, LacI family |
|
*
Psychromonas ingrahamii 37 Site: position = -200 score = 6.10106 sequence = ATTTGATAGCGCTATCTGAT Site: position = -187 score = 6.40142 sequence = ATCTGATAGCGCTATCAAAT Gene: Ping_2058: Ascorbate utilization transcriptional regulator SgaR, LacI family |
|
|
Ascorbate utilization transcriptional regulator SgaR, LacI family |
| CRON 2. | |||||||
| sgaA |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -127 score = 6.50021 sequence = AAATGATAGCGCTATCACAG Site: position = -92 score = 4.79295 sequence = ATCTGGTAGCGCTAACTTTC Gene: AHA_0173: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -127 score = 6.33806 sequence = AAATGATAGCGCTATCACAA Site: position = -105 score = 4.62619 sequence = CCATGTTAGCGCTATCTGGT Gene: ASA_4216: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
|
*
Psychromonas ingrahamii 37 Site: position = -118 score = 6.40142 sequence = ATTTGATAGCGCTATCAGAT Site: position = -105 score = 6.10106 sequence = ATCAGATAGCGCTATCAAAT Gene: Ping_2057: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
|
|
Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) |
| sgaB |
Gene: AHA_0172: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
Gene: ASA_4217: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
|
Gene: Ping_2056: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
|
|
Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) |
| sgaT |
Gene: AHA_0171: Ascorbate-specific PTS system, EIIC component |
Gene: ASA_4218: Ascorbate-specific PTS system, EIIC component |
|
Gene: Ping_2055: Ascorbate-specific PTS system, EIIC component |
|
|
Ascorbate-specific PTS system, EIIC component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |