Regulon of SgaR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type:	Transcription factor
TF locus tag:	ASA_4215
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 4.6 Sequence: ACCAGATAGCGCTAACATGG Position: -145 Score: 6.3 Sequence: TTGTGATAGCGCTATCATTT Locus tag: ASA_4215 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	ASA_4215	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family
Position: -127 Score: 6.3 Sequence: AAATGATAGCGCTATCACAA Position: -105 Score: 4.6 Sequence: CCATGTTAGCGCTATCTGGT Locus tag: ASA_4216 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: ASA_4217 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: ASA_4218 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	ASA_4216	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	ASA_4217	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	ASA_4218	sgaT	Ascorbate-specific PTS system, EIIC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD