Regulon of SgaR in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_2058
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	SgaR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By TF family - LacI
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -200 Score: 6.1 Sequence: ATTTGATAGCGCTATCTGAT Position: -187 Score: 6.4 Sequence: ATCTGATAGCGCTATCAAAT Locus tag: Ping_2058 Name: sgaR Funciton: Ascorbate utilization transcriptional regulator SgaR, LacI family
	Ping_2058	sgaR	Ascorbate utilization transcriptional regulator SgaR, LacI family
Position: -118 Score: 6.4 Sequence: ATTTGATAGCGCTATCAGAT Position: -105 Score: 6.1 Sequence: ATCAGATAGCGCTATCAAAT Locus tag: Ping_2057 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: Ping_2056 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: Ping_2055 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
	Ping_2057	sgaA	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	Ping_2056	sgaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	Ping_2055	sgaT	Ascorbate-specific PTS system, EIIC component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD