Orthologous regulated operons containing sgaA gene

Properties
Regulog:	SgaR - Psychromonadaceae/Aeromonadales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria/gamma

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Position: -127 Score: 6.50021 Sequence: AAATGATAGCGCTATCACAG Position: -92 Score: 4.79295 Sequence: ATCTGGTAGCGCTAACTTTC Locus tag: AHA_0173 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: AHA_0172 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: AHA_0171 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT	-127	6.5	AAATGATAGCGCTATCACAG	AHA_0173
	-92	4.8	ATCTGGTAGCGCTAACTTTC
Aeromonas salmonicida subsp. salmonicida A449
Position: -127 Score: 6.33806 Sequence: AAATGATAGCGCTATCACAA Position: -105 Score: 4.62619 Sequence: CCATGTTAGCGCTATCTGGT Locus tag: ASA_4216 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: ASA_4217 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: ASA_4218 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT	-127	6.3	AAATGATAGCGCTATCACAA	ASA_4216
	-105	4.6	CCATGTTAGCGCTATCTGGT
Psychromonas ingrahamii 37
Position: -118 Score: 6.40142 Sequence: ATTTGATAGCGCTATCAGAT Position: -105 Score: 6.10106 Sequence: ATCAGATAGCGCTATCAAAT Locus tag: Ping_2057 Name: sgaA Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-) Locus tag: Ping_2056 Name: sgaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: Ping_2055 Name: sgaT Funciton: Ascorbate-specific PTS system, EIIC component
sgaA-sgaB-sgaT	-118	6.4	ATTTGATAGCGCTATCAGAT	Ping_2057
	-105	6.1	ATCAGATAGCGCTATCAAAT