Regulog BgaR - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactosides utilization |
| Effector: | Beta-galactosides |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By effector - Beta-galactosides
- By pathway - Galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces scabiei 87.22 | 2 | 2 |
| Streptomyces griseus subsp. griseus NBRC 13350 | ||
| Streptomyces coelicolor A3(2) | 6 | 2 |
| Streptomyces avermitilis MA-4680 | 6 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| bgaR |
*
Streptomyces scabiei 87.22 Site: position = -184 score = 7.17867 sequence = GGATGTTTACGTAAACATCC Gene: SCAB_43681: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
|
*
Streptomyces coelicolor A3(2) Site: position = -156 score = 7.09567 sequence = TGATGTTTACGTAAACATGA Site: position = -111 score = 6.93314 sequence = TTATGTTTACGTAAACATCT Gene: SCO7411: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
*
Streptomyces avermitilis MA-4680 Site: position = -92 score = 6.93314 sequence = TTATGTTTACGTAAACATCT Gene: SAV_1031: Putative transcriptional regulator for beta-galactosides utilization, LacI family |
Putative transcriptional regulator for beta-galactosides utilization, LacI family |
| CRON 2. | |||||
| bgaZ |
|
|
*
Streptomyces coelicolor A3(2) Site: position = -101 score = 6.93314 sequence = AGATGTTTACGTAAACATAA Site: position = -56 score = 7.09567 sequence = TCATGTTTACGTAAACATCA Gene: SCO7410: Putative beta-galactoside ABC transport system, permease component 1 |
*
Streptomyces avermitilis MA-4680 Site: position = -110 score = 6.93314 sequence = AGATGTTTACGTAAACATAA Gene: SAV_1030: Putative beta-galactoside ABC transport system, permease component 1 |
Putative beta-galactoside ABC transport system, permease component 1 |
| bgaY |
|
|
Gene: SCO7409: Putative beta-galactoside ABC transport system, permease component 2 |
Gene: SAV_1029: Putative beta-galactoside ABC transport system, permease component 2 |
Putative beta-galactoside ABC transport system, permease component 2 |
| bgaX |
|
|
Gene: SCO7408: Putative beta-galactoside ABC transport system, periplasmic component |
Gene: SAV_1028: Putative beta-galactoside ABC transport system, periplasmic component |
Putative beta-galactoside ABC transport system, periplasmic component |
| bgaB |
|
|
Gene: SCO7407: Beta-galactosidase (EC 3.2.1.23) |
Gene: SAV_1027: Beta-galactosidase (EC 3.2.1.23) |
Beta-galactosidase (EC 3.2.1.23) |
| gal6 |
*
Streptomyces scabiei 87.22 Site: position = -186 score = 7.17867 sequence = GGATGTTTACGTAAACATCC Gene: SCAB_43661: Endo-beta-1,6-galactanase |
|
Gene: SCO7406: Endo-beta-1,6-galactanase |
Gene: SAV_1026: Endo-beta-1,6-galactanase |
Endo-beta-1,6-galactanase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |