Regulon of BgaR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO7411
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Streptomycetaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6.9 Sequence: AGATGTTTACGTAAACATAA Position: -56 Score: 7.1 Sequence: TCATGTTTACGTAAACATCA Locus tag: SCO7410 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: SCO7409 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: SCO7408 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component Locus tag: SCO7407 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: SCO7406 Name: gal6 Funciton: Endo-beta-1,6-galactanase
	SCO7410	bgaZ	Putative beta-galactoside ABC transport system, permease component 1
	SCO7409	bgaY	Putative beta-galactoside ABC transport system, permease component 2
	SCO7408	bgaX	Putative beta-galactoside ABC transport system, periplasmic component
	SCO7407	bgaB	Beta-galactosidase (EC 3.2.1.23)
	SCO7406	gal6	Endo-beta-1,6-galactanase
Position: -156 Score: 7.1 Sequence: TGATGTTTACGTAAACATGA Position: -111 Score: 6.9 Sequence: TTATGTTTACGTAAACATCT Locus tag: SCO7411 Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
	SCO7411	bgaR	Putative transcriptional regulator for beta-galactosides utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD