Regulon of BgaR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_43681
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Streptomycetaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -186 Score: 7.2 Sequence: GGATGTTTACGTAAACATCC Locus tag: SCAB_43661 Name: gal6 Funciton: Endo-beta-1,6-galactanase
	SCAB_43661	gal6	Endo-beta-1,6-galactanase
Position: -184 Score: 7.2 Sequence: GGATGTTTACGTAAACATCC Locus tag: SCAB_43681 Name: bgaR Funciton: Putative transcriptional regulator for beta-galactosides utilization, LacI family
	SCAB_43681	bgaR	Putative transcriptional regulator for beta-galactosides utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD