Regulog RbsR - Clostridia-1

Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
Genome | Genes | Operons |
---|---|---|
Clostridium acetobutylicum ATCC 824 | ||
Clostridium beijerincki NCIMB 8052 | ||
Clostridium botulinum A str. ATCC 3502 | ||
Clostridium butyricum 5521 | 7 | 1 |
Clostridium kluyveri DSM 555 | ||
Clostridium novyi NT | 6 | 1 |
Clostridium perfringens ATCC 13124 | 4 | 1 |
Clostridium tetani E88 | 6 | 1 |
Genes | Function | ||||||||
---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||
rbsD |
|
|
|
*
Clostridium butyricum 5521 Site: position = -120 score = 4.5724 sequence = TAATAGAAGCAGTTAAATTT Gene: CBY_2443: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
Gene: NT01CX_0165: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: CPF_1883: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: CTC02351: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
rbsA |
|
|
|
Gene: CBY_2442: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: NT01CX_0164: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: CPF_1882: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: CTC02350: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
rbsC |
|
|
|
Gene: CBY_2441: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Gene: NT01CX_0163: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: CPF_1881: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: CTC02349: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
rbsB |
|
|
|
Gene: CBY_2440: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: NT01CX_0162: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Gene: CTC02347: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
tal |
|
|
|
Gene: CBY_2439: transaldolase |
|
|
|
|
transaldolase |
tkt |
|
|
|
Gene: CBY_2438: transketolase |
|
|
|
|
transketolase |
rbsR |
|
|
|
Gene: CBY_2437: Ribose operon transcriptional regulator, LacI family |
|
Gene: NT01CX_0161: Ribose operon transcriptional regulator, LacI family |
Gene: CPF_1879: Ribose operon transcriptional regulator, LacI family |
Gene: CTC02346: Ribose operon transcriptional regulator, LacI family |
Ribose operon transcriptional regulator, LacI family |
rbsK |
|
|
|
|
|
*
Clostridium novyi NT Site: position = -65 score = 6.50822 sequence = TAATTTAACCGGTTAAATTA Gene: NT01CX_0166: Ribokinase (EC 2.7.1.15) |
*
Clostridium perfringens ATCC 13124 Site: position = -45 score = 4.91967 sequence = CTAGTTAATCGGTTCACTGA Site: position = -32 score = 6.50822 sequence = TCACTGAATCGGTTAACTAG Gene: CPF_1884: Ribokinase (EC 2.7.1.15) |
*
Clostridium tetani E88 Site: position = -37 score = 6.76527 sequence = TTAGTGAACCGGTTAAGTAA Gene: CTC02352: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |