Orthologous regulated operons containing rbsC gene

Properties
Regulog:	RbsR - Clostridia-1
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Firmicutes

Built upon 5 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Clostridium butyricum 5521
Position: -120 Score: 4.5724 Sequence: TAATAGAAGCAGTTAAATTT Locus tag: CBY_2443 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CBY_2442 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CBY_2441 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: CBY_2440 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: CBY_2439 Name: tal Funciton: transaldolase Locus tag: CBY_2438 Name: tkt Funciton: transketolase Locus tag: CBY_2437 Name: rbsR Funciton: Ribose operon transcriptional regulator, LacI family
rbsD-rbsA-rbsC-rbsB-tal-tkt-rbsR	-120	4.6	TAATAGAAGCAGTTAAATTT	CBY_2443
Clostridium novyi NT
Position: -65 Score: 6.50822 Sequence: TAATTTAACCGGTTAAATTA Locus tag: NT01CX_0166 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: NT01CX_0165 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: NT01CX_0164 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: NT01CX_0163 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: NT01CX_0162 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: NT01CX_0161 Name: rbsR Funciton: Ribose operon transcriptional regulator, LacI family
rbsK-rbsD-rbsA-rbsC-rbsB-rbsR	-65	6.5	TAATTTAACCGGTTAAATTA	NT01CX_0166
Clostridium perfringens ATCC 13124
Position: -45 Score: 4.91967 Sequence: CTAGTTAATCGGTTCACTGA Position: -32 Score: 6.50822 Sequence: TCACTGAATCGGTTAACTAG Locus tag: CPF_1884 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: CPF_1883 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CPF_1882 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CPF_1881 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsK-rbsD-rbsA-rbsC	-45	4.9	CTAGTTAATCGGTTCACTGA	CPF_1884
	-32	6.5	TCACTGAATCGGTTAACTAG
Clostridium tetani E88
Position: -37 Score: 6.76527 Sequence: TTAGTGAACCGGTTAAGTAA Locus tag: CTC02352 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: CTC02351 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CTC02350 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CTC02349 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: CTC02347 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: CTC02346 Name: rbsR Funciton: Ribose operon transcriptional regulator, LacI family
rbsK-rbsD-rbsA-rbsC-rbsB-rbsR	-37	6.8	TTAGTGAACCGGTTAAGTAA	CTC02352