Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbsC gene

Properties
Regulog: RbsR - Clostridia-1
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Clostridium butyricum 5521
Position: -120
Score: 4.5724
Sequence: TAATAGAAGCAGTTAAATTT
Locus tag: CBY_2443
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CBY_2442
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CBY_2441
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: CBY_2440
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: CBY_2439
Name: tal
Funciton: transaldolase
Locus tag: CBY_2438
Name: tkt
Funciton: transketolase
Locus tag: CBY_2437
Name: rbsR
Funciton: Ribose operon transcriptional regulator, LacI family
rbsD-rbsA-rbsC-rbsB-tal-tkt-rbsR -120 4.6 TAATAGAAGCAGTTAAATTT CBY_2443
Clostridium novyi NT
Position: -65
Score: 6.50822
Sequence: TAATTTAACCGGTTAAATTA
Locus tag: NT01CX_0166
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: NT01CX_0165
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: NT01CX_0164
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: NT01CX_0163
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: NT01CX_0162
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: NT01CX_0161
Name: rbsR
Funciton: Ribose operon transcriptional regulator, LacI family
rbsK-rbsD-rbsA-rbsC-rbsB-rbsR -65 6.5 TAATTTAACCGGTTAAATTA NT01CX_0166
Clostridium perfringens ATCC 13124
Position: -45
Score: 4.91967
Sequence: CTAGTTAATCGGTTCACTGA
Position: -32
Score: 6.50822
Sequence: TCACTGAATCGGTTAACTAG
Locus tag: CPF_1884
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: CPF_1883
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CPF_1882
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CPF_1881
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsK-rbsD-rbsA-rbsC -45 4.9 CTAGTTAATCGGTTCACTGA CPF_1884
-32 6.5 TCACTGAATCGGTTAACTAG
Clostridium tetani E88
Position: -37
Score: 6.76527
Sequence: TTAGTGAACCGGTTAAGTAA
Locus tag: CTC02352
Name: rbsK
Funciton: Ribokinase (EC 2.7.1.15)
Locus tag: CTC02351
Name: rbsD
Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
Locus tag: CTC02350
Name: rbsA
Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Locus tag: CTC02349
Name: rbsC
Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Locus tag: CTC02347
Name: rbsB
Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Locus tag: CTC02346
Name: rbsR
Funciton: Ribose operon transcriptional regulator, LacI family
rbsK-rbsD-rbsA-rbsC-rbsB-rbsR -37 6.8 TTAGTGAACCGGTTAAGTAA CTC02352