Regulon of RbsR in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_2437
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Clostridia-1
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 4.6 Sequence: TAATAGAAGCAGTTAAATTT Locus tag: CBY_2443 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CBY_2442 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CBY_2441 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: CBY_2440 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: CBY_2439 Name: tal Funciton: transaldolase Locus tag: CBY_2438 Name: tkt Funciton: transketolase Locus tag: CBY_2437 Name: rbsR Funciton: Ribose operon transcriptional regulator, LacI family
	CBY_2443	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	CBY_2442	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	CBY_2441	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	CBY_2440	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	CBY_2439	tal	transaldolase
	CBY_2438	tkt	transketolase
	CBY_2437	rbsR	Ribose operon transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD