Regulon of RbsR in Clostridium perfringens ATCC 13124

Properties
Regulator type:	Transcription factor
TF locus tag:	CPF_1879
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 4.9 Sequence: CTAGTTAATCGGTTCACTGA Position: -32 Score: 6.5 Sequence: TCACTGAATCGGTTAACTAG Locus tag: CPF_1884 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: CPF_1883 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: CPF_1882 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: CPF_1881 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	CPF_1884	rbsK	Ribokinase (EC 2.7.1.15)
	CPF_1883	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	CPF_1882	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	CPF_1881	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD