Regulog PtxS - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | 2-ketogluconate utilization |
| Effector: | 2-keto-D-gluconate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By effector - 2-keto-D-gluconate
- By pathway - 2-ketogluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | 7 | 2 |
| Burkholderia xenovorans LB400 | 7 | 1 |
| Burkholderia vietnamiensis G4 | 7 | 2 |
| Burkholderia sp. 383 | 7 | 2 |
| Burkholderia pseudomallei K96243 | 4 | 1 |
| Burkholderia phymatum STM815 | 7 | 1 |
| Burkholderia mallei ATCC 23344 | 3 | 1 |
| Burkholderia glumae BGR1 | 4 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| kguE |
*
Burkholderia cepacia AMMD Site: position = -39 score = 7.078 sequence = AAATGGAACCGGTTCCATTC Gene: Bamb_1655: Predicted epimerase/isomerase |
*
Burkholderia xenovorans LB400 Site: position = -52 score = 6.53653 sequence = ATTTGGAACCGGTTCCAAAT Gene: Bxe_A1979: Predicted epimerase/isomerase |
*
Burkholderia vietnamiensis G4 Site: position = -47 score = 7.078 sequence = AAATGGAACCGGTTCCATTC Gene: Bcep1808_1678: Predicted epimerase/isomerase |
*
Burkholderia sp. 383 Site: position = -37 score = 7.078 sequence = AAATGGAACCGGTTCCATTC Gene: Bcep18194_A5030: Predicted epimerase/isomerase |
*
Burkholderia pseudomallei K96243 Site: position = -61 score = 6.88355 sequence = GAATGGAACCGGTTCCATTT Gene: BPSL1574: Predicted epimerase/isomerase |
*
Burkholderia phymatum STM815 Site: position = -52 score = 5.82847 sequence = CTTTGGAACCGATTCCAAAG Gene: Bphy_1254: Predicted epimerase/isomerase |
*
Burkholderia mallei ATCC 23344 Site: position = -61 score = 6.93048 sequence = GAATGGAACCGGTTCCATTC Gene: BMA0960: Predicted epimerase/isomerase |
*
Burkholderia glumae BGR1 Site: position = -72 score = 6.61761 sequence = AACTGGAACCGGTTCCAAAT Gene: bglu_1g16220: Predicted epimerase/isomerase |
Predicted epimerase/isomerase |
| kguK |
Gene: Bamb_1654: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: Bxe_A1980: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: Bcep1808_1677: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: Bcep18194_A5029: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: BPSL1575: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: Bphy_1253: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: BMA0961: 2-ketogluconate kinase (EC 2.7.1.13) |
Gene: bglu_1g16230: 2-ketogluconate kinase (EC 2.7.1.13) |
2-ketogluconate kinase (EC 2.7.1.13) |
| kguT |
Gene: Bamb_1653: 2-ketogluconate transporter |
Gene: Bxe_A1981: 2-ketogluconate transporter |
Gene: Bcep1808_1676: 2-ketogluconate transporter |
Gene: Bcep18194_A5028: 2-ketogluconate transporter |
Gene: BPSL1576: 2-ketogluconate transporter |
Gene: Bphy_1252: 2-ketogluconate transporter |
Gene: BMA0962: 2-ketogluconate transporter |
Gene: bglu_1g16240: 2-ketogluconate transporter |
2-ketogluconate transporter |
| kguD |
Gene: Bamb_1652: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: Bxe_A1982: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: Bcep1808_1675: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: Bcep18194_A5027: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: BPSL1577: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
Gene: Bphy_1251: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
|
Gene: bglu_1g16250: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) |
| ptxS |
Gene: Bamb_1651: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: Bxe_A1983: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: Bcep1808_1674: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: Bcep18194_A5026: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: BPSL1578: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: Bphy_1250: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: BMA0965: 2-ketogluconate utilization repressor PtxS, LacI family |
Gene: bglu_1g16260: 2-ketogluconate utilization repressor PtxS, LacI family |
2-ketogluconate utilization repressor PtxS, LacI family |
| kguM |
Gene: Bamb_1650: Membrane protein in 2-ketogluconate utilization locus |
Gene: Bxe_A1984: Membrane protein in 2-ketogluconate utilization locus |
Gene: Bcep1808_1673: Membrane protein in 2-ketogluconate utilization locus |
Gene: Bcep18194_A5025: Membrane protein in 2-ketogluconate utilization locus |
Gene: BPSL1579: Membrane protein in 2-ketogluconate utilization locus |
Gene: Bphy_1249: Membrane protein in 2-ketogluconate utilization locus |
Gene: BMA0966: Membrane protein in 2-ketogluconate utilization locus |
Gene: bglu_1g16270: Membrane protein in 2-ketogluconate utilization locus |
Membrane protein in 2-ketogluconate utilization locus |
| kguX |
Gene: Bamb_1649: Conserved hypothetical protein |
Gene: Bxe_A1985: Conserved hypothetical protein |
Gene: Bcep1808_1672: Conserved hypothetical protein |
Gene: Bcep18194_A5024: Conserved hypothetical protein |
Gene: BPSL1580: Conserved hypothetical protein |
Gene: Bphy_1248: Conserved hypothetical protein |
Gene: BMA0967: Conserved hypothetical protein |
Gene: bglu_1g16280: Conserved hypothetical protein |
Conserved hypothetical protein |
| CRON 2. | |||||||||
| gadC |
*
Burkholderia cepacia AMMD Site: position = -310 score = 5.77195 sequence = CAATGGAACCGGTTCTATCT Gene: Bamb_3645: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, gamma subunit |
|
*
Burkholderia vietnamiensis G4 Site: position = -270 score = 6.78613 sequence = CAATGGAACCGGTTCCATTT Gene: Bcep1808_4793: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, gamma subunit |
*
Burkholderia sp. 383 Site: position = -337 score = 5.98228 sequence = TGATGGAACCGGTTCCATAT Gene: Bcep18194_B1794: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, gamma subunit |
|
|
|
|
Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, gamma subunit |
| gadB |
Gene: Bamb_3646: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound flavoprotein subunit |
|
Gene: Bcep1808_4794: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound flavoprotein subunit |
Gene: Bcep18194_B1793: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound flavoprotein subunit |
|
|
|
|
Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound flavoprotein subunit |
| gadA |
Gene: Bamb_3647: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, cytochrome c subunit |
|
Gene: Bcep1808_4795: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, cytochrome c subunit |
Gene: Bcep18194_B1792: Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, cytochrome c subunit |
|
|
|
|
Gluconate 2-dehydrogenase (EC 1.1.99.3), membrane-bound, cytochrome c subunit |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |