Regulon of PtxS in Burkholderia mallei ATCC 23344

Properties
Regulator type:	Transcription factor
TF locus tag:	BMA0965
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Burkholderia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.9 Sequence: GAATGGAACCGGTTCCATTC Locus tag: BMA0960 Name: kguE Funciton: Predicted epimerase/isomerase Locus tag: BMA0961 Name: kguK Funciton: 2-ketogluconate kinase (EC 2.7.1.13) Locus tag: BMA0962 Name: kguT Funciton: 2-ketogluconate transporter
	BMA0960	kguE	Predicted epimerase/isomerase
	BMA0961	kguK	2-ketogluconate kinase (EC 2.7.1.13)
	BMA0962	kguT	2-ketogluconate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD