Regulon of PtxS in Burkholderia phymatum STM815

Properties
Regulator type:	Transcription factor
TF locus tag:	Bphy_1250
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Burkholderia
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.8 Sequence: CTTTGGAACCGATTCCAAAG Locus tag: Bphy_1254 Name: kguE Funciton: Predicted epimerase/isomerase Locus tag: Bphy_1253 Name: kguK Funciton: 2-ketogluconate kinase (EC 2.7.1.13) Locus tag: Bphy_1252 Name: kguT Funciton: 2-ketogluconate transporter Locus tag: Bphy_1251 Name: kguD Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43) Locus tag: Bphy_1250 Name: ptxS Funciton: 2-ketogluconate utilization repressor PtxS, LacI family Locus tag: Bphy_1249 Name: kguM Funciton: Membrane protein in 2-ketogluconate utilization locus Locus tag: Bphy_1248 Name: kguX Funciton: Conserved hypothetical protein
	Bphy_1254	kguE	Predicted epimerase/isomerase
	Bphy_1253	kguK	2-ketogluconate kinase (EC 2.7.1.13)
	Bphy_1252	kguT	2-ketogluconate transporter
	Bphy_1251	kguD	2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
	Bphy_1250	ptxS	2-ketogluconate utilization repressor PtxS, LacI family
	Bphy_1249	kguM	Membrane protein in 2-ketogluconate utilization locus
	Bphy_1248	kguX	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD