Regulon of PtxS in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_1g16260
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	2-ketogluconate utilization
Effector:	2-keto-D-gluconate
Regulog:	PtxS - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By effector - 2-keto-D-gluconate
By pathway - 2-ketogluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.6 Sequence: AACTGGAACCGGTTCCAAAT Locus tag: bglu_1g16220 Name: kguE Funciton: Predicted epimerase/isomerase Locus tag: bglu_1g16230 Name: kguK Funciton: 2-ketogluconate kinase (EC 2.7.1.13) Locus tag: bglu_1g16240 Name: kguT Funciton: 2-ketogluconate transporter Locus tag: bglu_1g16250 Name: kguD Funciton: 2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)
	bglu_1g16220	kguE	Predicted epimerase/isomerase
	bglu_1g16230	kguK	2-ketogluconate kinase (EC 2.7.1.13)
	bglu_1g16240	kguT	2-ketogluconate transporter
	bglu_1g16250	kguD	2-ketogluconate 6-phosphate reductase (EC 1.1.1.43)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD