Regulog KojR - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Kojibiose utilization |
| Effector: | Kojibiose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By effector - Kojibiose
- By pathway - Kojibiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | 6 | 2 |
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | ||
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | 5 | 2 |
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| kojP |
*
Anoxybacillus flavithermus WK1 Site: position = -13 score = 6.78028 sequence = AATCCGAAACGTTTTGGGAA Gene: Aflv_2025: Kojibiose phosphorylase (EC 2.4.1.230) |
|
|
|
|
|
|
|
|
|
|
Kojibiose phosphorylase (EC 2.4.1.230) |
| pgmB |
Gene: Aflv_2024: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
|
|
Gene: BLi00665: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
Gene: BSU34550: Beta-phosphoglucomutase (EC 5.4.2.6) |
|
|
|
Beta-phosphoglucomutase (EC 5.4.2.6) |
| kojE |
Gene: Aflv_2023: Kojibiose ABC transporter, substrate-binding protein |
|
|
|
Gene: BH3690: Kojibiose ABC transporter, substrate-binding protein |
|
|
|
|
|
|
Kojibiose ABC transporter, substrate-binding protein |
| kojF |
Gene: Aflv_2022: Kojibiose ABC transporter, permease protein 1 |
|
|
|
Gene: BH3689: Kojibiose ABC transporter, permease protein 1 |
|
|
|
|
|
|
Kojibiose ABC transporter, permease protein 1 |
| kojG |
Gene: Aflv_2021: Kojibiose ABC transporter, permease protein 2 |
|
|
|
Gene: BH3688: Kojibiose ABC transporter, permease protein 2 |
|
|
|
|
|
|
Kojibiose ABC transporter, permease protein 2 |
| gdb1 |
|
|
|
|
*
Bacillus halodurans C-125 Site: position = -153 score = 6.96966 sequence = AAACCGAAACGTTTTGGATT Site: position = -55 score = 5.51561 sequence = GATCCAAAACGTTTCGGATG Gene: BH3691: Glycogen debranching enzyme |
|
|
|
|
|
|
Glycogen debranching enzyme |
| CRON 2. | ||||||||||||
| kojR |
*
Anoxybacillus flavithermus WK1 Site: position = -13 score = 7.20163 sequence = AATCCGAAACGTTTTGGAGG Gene: Aflv_2026: Kojibiose transcriptional regulator KojR, LacI family |
|
|
|
*
Bacillus halodurans C-125 Site: position = -26 score = 7.01225 sequence = CAACCGAAACGTTTTGGAGG Gene: BH3692: Kojibiose transcriptional regulator KojR, LacI family |
|
|
|
|
|
|
Kojibiose transcriptional regulator KojR, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |