Regulon of KojR in Bacillus halodurans C-125

Properties
Regulator type:	Transcription factor
TF locus tag:	BH3692
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 7 Sequence: AAACCGAAACGTTTTGGATT Position: -55 Score: 5.5 Sequence: GATCCAAAACGTTTCGGATG Locus tag: BH3691 Name: gdb1 Funciton: Glycogen debranching enzyme Locus tag: BH3690 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: BH3689 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: BH3688 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2
	BH3691	gdb1	Glycogen debranching enzyme
	BH3690	kojE	Kojibiose ABC transporter, substrate-binding protein
	BH3689	kojF	Kojibiose ABC transporter, permease protein 1
	BH3688	kojG	Kojibiose ABC transporter, permease protein 2
Position: -26 Score: 7 Sequence: CAACCGAAACGTTTTGGAGG Locus tag: BH3692 Name: kojR Funciton: Kojibiose transcriptional regulator KojR, LacI family
	BH3692	kojR	Kojibiose transcriptional regulator KojR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD