Regulon of KojR in Anoxybacillus flavithermus WK1

Properties
Regulator type:	Transcription factor
TF locus tag:	Aflv_2026
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Kojibiose utilization
Effector:	Kojibiose
Regulog:	KojR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Kojibiose
By pathway - Kojibiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 6.8 Sequence: AATCCGAAACGTTTTGGGAA Locus tag: Aflv_2025 Name: kojP Funciton: Kojibiose phosphorylase (EC 2.4.1.230) Locus tag: Aflv_2024 Name: pgmB Funciton: Beta-phosphoglucomutase (EC 5.4.2.6) Locus tag: Aflv_2023 Name: kojE Funciton: Kojibiose ABC transporter, substrate-binding protein Locus tag: Aflv_2022 Name: kojF Funciton: Kojibiose ABC transporter, permease protein 1 Locus tag: Aflv_2021 Name: kojG Funciton: Kojibiose ABC transporter, permease protein 2
	Aflv_2025	kojP	Kojibiose phosphorylase (EC 2.4.1.230)
	Aflv_2024	pgmB	Beta-phosphoglucomutase (EC 5.4.2.6)
	Aflv_2023	kojE	Kojibiose ABC transporter, substrate-binding protein
	Aflv_2022	kojF	Kojibiose ABC transporter, permease protein 1
	Aflv_2021	kojG	Kojibiose ABC transporter, permease protein 2
Position: -13 Score: 7.2 Sequence: AATCCGAAACGTTTTGGAGG Locus tag: Aflv_2026 Name: kojR Funciton: Kojibiose transcriptional regulator KojR, LacI family
	Aflv_2026	kojR	Kojibiose transcriptional regulator KojR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD