Statistics of regulated genes

Genome	Genes	Operons
Stenotrophomonas maltophilia K279a	11	6
Xylella fastidiosa 9a5c
Xanthomonas campestris pv. campestris str. ATCC 33913	12	7
Xanthomonas axonopodis pv. citri str. 306	12	7

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
COG3137	Stenotrophomonas maltophilia K279a Gene: Smlt4128: Putative salt-induced outer membrane protein	Xylella fastidiosa 9a5c Gene: XF1628: Putative salt-induced outer membrane protein	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -55 score = 5.54814 sequence = TCATGAAATCGCTTTCACCT Gene: XCC3510: Putative salt-induced outer membrane protein	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -49 score = 5.64343 sequence = TCATGAAATCGCTTTCACCC Gene: XAC0623: Putative salt-induced outer membrane protein	Putative salt-induced outer membrane protein
CRON 2.
omp2	* Stenotrophomonas maltophilia K279a Site: position = -42 score = 5.51813 sequence = ATCTGAAAGCGATTACACCC Gene: Smlt1175: Putative carbohydrate outer membrane transporter, TonB-dependent	Xylella fastidiosa 9a5c	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -124 score = 5.06421 sequence = CAGTGGAATCGATTTCAGCA Gene: XCC2469: Putative carbohydrate outer membrane transporter, TonB-dependent	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -118 score = 5.34505 sequence = GGATGGAATCGATTTCATCG Gene: XAC2600: Putative carbohydrate outer membrane transporter, TonB-dependent	Putative carbohydrate outer membrane transporter, TonB-dependent
CRON 3.
ugpC	* Stenotrophomonas maltophilia K279a Site: position = -148 score = 5.7533 sequence = ACGTGAAAACGTTTACATGG Gene: Smlt1794: Multiple sugar ABC transporter, ATP-binding protein	Xylella fastidiosa 9a5c Gene: XF1067: Multiple sugar ABC transporter, ATP-binding protein	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -130 score = 5.80311 sequence = ATGTGAAAACGATTACATGT Gene: XCC2135: Multiple sugar ABC transporter, ATP-binding protein	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -130 score = 5.80311 sequence = ATGTGAAAACGATTACATGT Gene: XAC2072: Multiple sugar ABC transporter, ATP-binding protein	Multiple sugar ABC transporter, ATP-binding protein
CRON 4.
XCC2209	* Stenotrophomonas maltophilia K279a Site: position = -46 score = 5.65592 sequence = AGATGGAAACGCTTACATTC Gene: Smlt3255: Transcriptional regulator, LacI family	Xylella fastidiosa 9a5c	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -107 score = 5.50786 sequence = ATCTGTAAGCGTTTTCACAA Site: position = -61 score = 5.52803 sequence = GTATGAAAACGCTTACAGTC Gene: XCC2209: Transcriptional regulator, LacI family	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -106 score = 5.56585 sequence = ATCTGTAAGCGTTTTCACGC Site: position = -60 score = 5.52803 sequence = GTATGAAAACGCTTACAGTC Gene: XAC2313: Transcriptional regulator, LacI family	Transcriptional regulator, LacI family
omp	Stenotrophomonas maltophilia K279a Gene: Smlt3254: Putative carbohydrate outer membrane transporter, TonB-dependent	Xylella fastidiosa 9a5c	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2208: Putative carbohydrate outer membrane transporter, TonB-dependent	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2312: Putative carbohydrate outer membrane transporter, TonB-dependent	Putative carbohydrate outer membrane transporter, TonB-dependent
CRON 5.
COG5368	* Stenotrophomonas maltophilia K279a Site: position = -31 score = 5.61436 sequence = CCTTGTAAACGATTTCAGAT Gene: Smlt3253: Hypothetical sugar hydrolase	Xylella fastidiosa 9a5c Gene: XF2449: Hypothetical sugar hydrolase	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -31 score = 5.86824 sequence = AGATGTAATCGATTACACGA Gene: XCC2207: Hypothetical sugar hydrolase	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -31 score = 5.92623 sequence = AGATGTAATCGATTACACAC Gene: XAC2311: Hypothetical sugar hydrolase	Hypothetical sugar hydrolase
ugpB	Stenotrophomonas maltophilia K279a Gene: Smlt3252: Sugar ABC transporter, periplasmic sugar-binding protein	Xylella fastidiosa 9a5c Gene: XF2448: Sugar ABC transporter, periplasmic sugar-binding protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2206: Sugar ABC transporter, periplasmic sugar-binding protein	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2310: Sugar ABC transporter, periplasmic sugar-binding protein	Sugar ABC transporter, periplasmic sugar-binding protein
ugpA	Stenotrophomonas maltophilia K279a Gene: Smlt3251: Sugar ABC transporter, sugar permease protein 1	Xylella fastidiosa 9a5c Gene: XF2447: Sugar ABC transporter, sugar permease protein 1	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2205: Sugar ABC transporter, sugar permease protein 1	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2309: Sugar ABC transporter, sugar permease protein 1	Sugar ABC transporter, sugar permease protein 1
ugpE	Stenotrophomonas maltophilia K279a Gene: Smlt3250: Sugar ABC transporter, sugar permease protein 2	Xylella fastidiosa 9a5c Gene: XF2446: Sugar ABC transporter, sugar permease protein 2	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2204: Sugar ABC transporter, sugar permease protein 2	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2308: Sugar ABC transporter, sugar permease protein 2	Sugar ABC transporter, sugar permease protein 2
COG3408	Stenotrophomonas maltophilia K279a Gene: Smlt3249: Hypothetical sugar binding and hydrolysis protein	Xylella fastidiosa 9a5c Gene: XF2445: Hypothetical sugar binding and hydrolysis protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2203: Hypothetical sugar binding and hydrolysis protein	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2307: Hypothetical sugar binding and hydrolysis protein	Hypothetical sugar binding and hydrolysis protein
CRON 6.
bglX	* Stenotrophomonas maltophilia K279a Site: position = -30 score = 5.69664 sequence = GCTTGTAAACGTTTTCATCA Gene: Smlt0449: Beta-glucosidase (EC 3.2.1.21)	Xylella fastidiosa 9a5c Gene: XF0439: Beta-glucosidase (EC 3.2.1.21)	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -27 score = 5.75767 sequence = CCATGTAAACGTTTTCTCAA Gene: XCC3814: Beta-glucosidase (EC 3.2.1.21)	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -27 score = 5.75767 sequence = CCATGTAAACGTTTTCTCAA Gene: XAC3869: Beta-glucosidase (EC 3.2.1.21)	Beta-glucosidase (EC 3.2.1.21)
CRON 7.
PF10947	* Stenotrophomonas maltophilia K279a Site: position = -36 score = 5.69804 sequence = TCATGAAAACGTTTTCTCAC Gene: Smlt4137: hypothetical protein	Xylella fastidiosa 9a5c	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -33 score = 5.61934 sequence = TCATGTAAACGCTTTCAATC Gene: XCC4223: hypothetical protein	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -32 score = 5.74942 sequence = TCATGTAAACGTTTACAACT Gene: XAC4357: hypothetical protein	hypothetical protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD