Regulon of XCC2209 in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC2313
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	XCC2209 - Xanthomonadales
Statistics of regulated genes:
- Genes	12
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -31 Score: 5.9 Sequence: AGATGTAATCGATTACACAC Locus tag: XAC2311 Name: COG5368 Funciton: Hypothetical sugar hydrolase Locus tag: XAC2310 Name: ugpB Funciton: Sugar ABC transporter, periplasmic sugar-binding protein Locus tag: XAC2309 Name: ugpA Funciton: Sugar ABC transporter, sugar permease protein 1 Locus tag: XAC2308 Name: ugpE Funciton: Sugar ABC transporter, sugar permease protein 2 Locus tag: XAC2307 Name: COG3408 Funciton: Hypothetical sugar binding and hydrolysis protein
	XAC2311	COG5368	Hypothetical sugar hydrolase
	XAC2310	ugpB	Sugar ABC transporter, periplasmic sugar-binding protein
	XAC2309	ugpA	Sugar ABC transporter, sugar permease protein 1
	XAC2308	ugpE	Sugar ABC transporter, sugar permease protein 2
	XAC2307	COG3408	Hypothetical sugar binding and hydrolysis protein
Position: -49 Score: 5.6 Sequence: TCATGAAATCGCTTTCACCC Locus tag: XAC0623 Name: COG3137 Funciton: Putative salt-induced outer membrane protein
	XAC0623	COG3137	Putative salt-induced outer membrane protein
Position: -106 Score: 5.6 Sequence: ATCTGTAAGCGTTTTCACGC Position: -60 Score: 5.5 Sequence: GTATGAAAACGCTTACAGTC Locus tag: XAC2313 Name: XCC2209 Funciton: Transcriptional regulator, LacI family Locus tag: XAC2312 Name: omp Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent
	XAC2313	XCC2209	Transcriptional regulator, LacI family
	XAC2312	omp	Putative carbohydrate outer membrane transporter, TonB-dependent
Position: -27 Score: 5.8 Sequence: CCATGTAAACGTTTTCTCAA Locus tag: XAC3869 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
	XAC3869	bglX	Beta-glucosidase (EC 3.2.1.21)
Position: -32 Score: 5.7 Sequence: TCATGTAAACGTTTACAACT Locus tag: XAC4357 Name: PF10947 Funciton: hypothetical protein
	XAC4357	PF10947	hypothetical protein
Position: -130 Score: 5.8 Sequence: ATGTGAAAACGATTACATGT Locus tag: XAC2072 Name: ugpC Funciton: Multiple sugar ABC transporter, ATP-binding protein
	XAC2072	ugpC	Multiple sugar ABC transporter, ATP-binding protein
Position: -118 Score: 5.3 Sequence: GGATGGAATCGATTTCATCG Locus tag: XAC2600 Name: omp2 Funciton: Putative carbohydrate outer membrane transporter, TonB-dependent
	XAC2600	omp2	Putative carbohydrate outer membrane transporter, TonB-dependent

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD