Regulog GalR - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Alteromonadales bacterium TW-7 | ||
| Alteromonas macleodii 'Deep ecotype' | 6 | 4 |
| Colwellia psychrerythraea 34H | ||
| Glaciecola sp. HTCC2999 | ||
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR | ||
| Pseudoalteromonas atlantica T6c | ||
| Pseudoalteromonas haloplanktis TAC125 | 5 | 2 |
| Pseudoalteromonas tunicata D2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| galR |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -169 score = 5.28413 sequence = GAGGTTATACGTTTTCCGTT Gene: MADE_00229: Transcriptional regulator for galactose utilization, LacI family |
|
|
|
|
2
Pseudoalteromonas atlantica T6c Gene: Patl_2679: Transcriptional regulator for galactose utilization, LacI family Gene: Patl_2681: Transcriptional regulator for galactose utilization, LacI family |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -111 score = 6.31547 sequence = AAGGGTAAACGCTTACCCCG Gene: PSHAa1771: Transcriptional regulator for galactose utilization, LacI family |
|
Transcriptional regulator for galactose utilization, LacI family |
| CRON 2. | ||||||||||
| omp_Gal |
|
*
Alteromonas macleodii 'Deep ecotype' Site: position = -140 score = 6.06778 sequence = TATGGTAAACGTTTACCCAA Gene: MADE_00241: Predicted galactose-specific outer membrane transporter, TonB-dependent |
|
|
|
|
|
|
|
Predicted galactose-specific outer membrane transporter, TonB-dependent |
| lacZ |
|
Gene: MADE_00239: Beta-galactosidase (EC 3.2.1.23) |
|
|
|
|
|
|
|
Beta-galactosidase (EC 3.2.1.23) |
| CRON 3. | ||||||||||
| galT |
Gene: ATW7_15001: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -136 score = 6.38072 sequence = TAGGGTAAACGTTTAACCCT Gene: MADE_00231: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
|
|
|
|
Gene: Patl_0648: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -54 score = 6.31547 sequence = CGGGGTAAGCGTTTACCCTT Gene: PSHAa1770: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
|
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) |
| galK |
Gene: ATW7_15006: Galactokinase (EC 2.7.1.6) |
Gene: MADE_00232: Galactokinase (EC 2.7.1.6) |
|
|
|
|
Gene: Patl_0647: Galactokinase (EC 2.7.1.6) |
Gene: PSHAa1769: Galactokinase (EC 2.7.1.6) |
|
Galactokinase (EC 2.7.1.6) |
| galP |
|
Gene: MADE_00234: Predicted sodium-dependent galactose transporter |
|
|
|
|
Gene: Patl_2683: Predicted sodium-dependent galactose transporter |
Gene: PSHAa1768: Predicted sodium-dependent galactose transporter |
|
Predicted sodium-dependent galactose transporter |
| galM |
Gene: ATW7_15071: Aldose 1-epimerase (EC 5.1.3.3) |
*
Alteromonas macleodii 'Deep ecotype' Site: position = -123 score = 5.28413 sequence = AACGGAAAACGTATAACCTC Gene: MADE_00230: Aldose 1-epimerase (EC 5.1.3.3) |
|
|
|
|
|
Gene: PSHAa1767: Aldose 1-epimerase (EC 5.1.3.3) |
|
Aldose 1-epimerase (EC 5.1.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |